Sequence ID | >SRA1014543 |
Genome ID | SRR023845.192077 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 256 |
End posion on genome | 177 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
tctgaattac |
tRNA gene sequence |
GGTGCTATAGCATAGTGGTTATGCAGTGTACTGTTAATGCATGGTTTTATCCAACGAAAG |
Downstream region at tRNA end position |
ctccacgatt |
Secondary structure (Cloverleaf model) | >SRA1014543 Asn GTT c Ttct ctccacgatt G - C G - C T - A G - C C - G T - A A - T T A T C T T T C A G A A | | | | | G T T A C G G A A A G C G | | | | T T G A T G C T T A GGTTTTATCCAAC G + T T - A G - C T + G A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |