Sequence ID | >SRA1014549 |
Genome ID | SRR023845.194021 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 94 |
End posion on genome | 169 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
tagcctcttc |
tRNA gene sequence |
GCTGGCGTAGCTCAGTTGGTAGAGCAACTGATTTGTAATCAGTAGGTCGTCGGTTCAAAT |
Downstream region at tRNA end position |
gcgtccaaac |
Secondary structure (Cloverleaf model) | >SRA1014549 Thr TGT c TCCA gcgtccaaac G - C C - G T - A G + T G - C C - G G - C T A T C A G C C A T G A A | | | | | A T C T C G G T C G G C G | | | | T T G G A G C T A A AGGTC A - T C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |