Sequence ID | >SRA1014550 |
Genome ID | SRR023845.194144 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 164 |
End posion on genome | 84 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ttaagcaaat |
tRNA gene sequence |
GGGGGTATCGCATAGCGGCAATTGCGGGTGACTGTAACTCACCTCCTTCGGGTTCATAGG |
Downstream region at tRNA end position |
ttgaaaaagt |
Secondary structure (Cloverleaf model) | >SRA1014550 Tyr GTA t ACat ttgaaaaagt G - C G - C G - C G - C G - C T - A A - T T G T T G T C C A C G A C | + | | | G G T A C G A T A G G C G | | | T T C T T G C A A G TCCTTCGGGTTC G - C G - C T - A G - C A - T C C T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |