Sequence ID | >SRA1014571 |
Genome ID | SRR023845.206041 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 98 |
End posion on genome | 8 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
nnnnnnngcg |
tRNA gene sequence |
GNGGCGGTGGCCGAGTGGTCGAAGGCGCTCGCCTGGAAAGTGAGTATACGTCAAAAGCGT |
Downstream region at tRNA end position |
ccaccaannn |
Secondary structure (Cloverleaf model) | >SRA1014571 Ser GGA g GCCA ccaccaannn G - C N C G + T G - C C - G G - C G - C T A T C A C C C A T G A G | | | | | G G G C C G G T G G G C G | | | T T T A G G C C G A G TATACGTCAAAAGCGTATC C - G T - A C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |