Sequence ID | >SRA1014580 |
Genome ID | SRR023845.209227 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 164 |
End posion on genome | 88 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
aacgggaaac |
tRNA gene sequence |
GCATTCGTAGCTCAATTGGATAGAGCACCTGACTACGGATCAGGAGGGTTTTGGGGTTCG |
Downstream region at tRNA end position |
tgattatcag |
Secondary structure (Cloverleaf model) | >SRA1014580 Arg ACG c ACat tgattatcag G - C C - G A - T T + G T - A C - G G - C T A T A T C C C A T A A A | + | | | G T C T C G T G G G G C G | | | | T T G G A G C A T A A AGGGTTT C - G C - G T - A G - C A - T C A T G A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |