Sequence ID | >SRA1014583 |
Genome ID | SRR023845.211545 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 125 |
End posion on genome | 214 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tggagcccgg |
tRNA gene sequence |
GGAGGCTTCGCCTAGTCCGGTCTATGGCGCCGCACTGCTAATGCGGTTTGGGTTTTGGCC |
Downstream region at tRNA end position |
aacaactgaa |
Secondary structure (Cloverleaf model) | >SRA1014583 Ser GCT g GCgc aacaactgaa G - C G - C A - T G - C G - C C - G T - A T A T G G C C C A C T G A C | | | | | A C T C C G C C G G G C G | | | T T G T G G C T C T A G TTTGGGTTTTGGCCCATC C - G C - G G - C C - G A - T C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |