Sequence ID | >SRA1014585 |
Genome ID | SRR023845.212295 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 31 |
End posion on genome | 102 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
acatgaaata |
tRNA gene sequence |
GGTCGGCTGGCCCAATGGCAAGGCGCTTGACTACGAATCAAGAGATTGCAGGTTCGATCC |
Downstream region at tRNA end position |
atcatctgct |
Secondary structure (Cloverleaf model) | >SRA1014585 Arg ACG a Aaaa atcatctgct G - C G + T T - A C - G G - C G + T C - G C T T C G T C C A A A G | | | | | G T C C C G G C A G G C G | | | T T G A G G C C A G AGATT C - G T - A T - A G - C A - T C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |