Sequence ID | >SRA1014595 |
Genome ID | SRR023845.216358 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 25 |
End posion on genome | 100 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
atcgcagcac |
tRNA gene sequence |
GCACCTCTAGCTCAATTGGCAGAGCAACTGACTCTTAATCAGTGGGTTCTCGGTTCAAGT |
Downstream region at tRNA end position |
aaaggcccga |
Secondary structure (Cloverleaf model) | >SRA1014595 Lys CTT c ACCG aaaggcccga G - C C N A - T C - G C - G T + G C - G T G T G A G C C A T A A A | | | | | A T C T C G C T C G G C G | | | | T T G G A G C C A A GGGTT A - T C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |