Sequence ID | >SRA1014596 |
Genome ID | SRR023845.216876 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 81 |
End posion on genome | 10 |
Amino Acid | Thr |
Anticodon | AGT |
Upstream region at tRNA start position |
ggctgtaaga |
tRNA gene sequence |
GCCCCTATAGCTCAGTGGTAGAGCACCCGCTTAGTAAGCGGAAGGTCGGTAGTTCAATCC |
Downstream region at tRNA end position |
aattcannnn |
Secondary structure (Cloverleaf model) | >SRA1014596 Thr AGT a Aaat aattcannnn G - C C - G C - G C - G C - G T + G A - T C T T C C G T C A G A A | | + | | A T C T C G G G T A G C G | | | | T T G G A G C T A A AGGTC C A C - G C - G G - C C - G T A T A A G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |