Sequence ID | >SRA1014602 |
Genome ID | SRR023845.220667 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 69 |
End posion on genome | 145 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
gttggcaact |
tRNA gene sequence |
GGGGAGTTAGCTCAGCTGGTTAGAGCGCTACCTTGACATGGTAGAGGTCATCGGTTCGAT |
Downstream region at tRNA end position |
aaacccctct |
Secondary structure (Cloverleaf model) | >SRA1014602 Val GAC t ACCA aaacccctct G - C G - C G - C G G A - T G - C T - A T T T T A G C C A C G A A | | | | | G T C T C G A T C G G C G | | | | T T G G A G C T T A G AGGTC C - G T - A A - T C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |