Sequence ID | >SRA1014605 |
Genome ID | SRR023845.223015 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 172 |
End posion on genome | 91 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tccaagaaaa |
tRNA gene sequence |
GACAACGTGGCCGAGTGGTTAAGGCGTCAGCCTGCTAAGTTGATGGGCTTTGCCCGCGTG |
Downstream region at tRNA end position |
tcatttttat |
Secondary structure (Cloverleaf model) | >SRA1014605 Ser GCT a Gaat tcatttttat G - C A - T C - G A - T A - T C - G G - C T A T C A C C C A T G A G | | | | | A G G C C G G T G G G C G | | | T T T A G G C T A G TGGGCTTTGCCCGC T - A C - G A - T G + T C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |