Sequence ID | >SRA1014608 |
Genome ID | SRR023845.224551 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 25 |
End posion on genome | 100 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
ttacacatcc |
tRNA gene sequence |
GGCCCCGTAGCTCAGAGGATAGAGCACCGGCCTTCTAAGCCGATGGTCGCAGGTTCGAAT |
Downstream region at tRNA end position |
acattttcgg |
Secondary structure (Cloverleaf model) | >SRA1014608 Arg TCT c GCCA acattttcgg G - C G + T C - G C - G C - G C - G G - C T A T C G T C C A A G A A | | | | | G G C T C G G C A G G C G | | | | T T A G A G C T A A TGGTC C A C - G G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |