| Sequence ID | >SRA1014614 |
| Genome ID | SRR023845.228205 |
| Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
| Species | |
| Start position on genome | 212 |
| End posion on genome | 126 |
| Amino Acid | Leu |
| Anticodon | CAG |
| Upstream region at tRNA start position |
ctacgagttc |
| tRNA gene sequence |
GCGCGAGTGGCGGAATTGGCAGACGCGCTGGCTTCAGGTGCCAGTGCTCGAAAGGGCGTG |
| Downstream region at tRNA end position |
acgtgaaggc |
| Secondary structure (Cloverleaf model) | >SRA1014614 Leu CAG
c ACGA acgtgaaggc
G - C
C - G
G - C
C - G
G - C
A - T
G - C T G
T C C C C C A
T A A G | | | | | A
T G G C G G G G G G C
G | | | T T
G A C G C
C A G G TGCTCGAAAGGGCGT
C - G
T - A
G - C
G - C
C - G
T T
T G
C A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |