Sequence ID | >SRA1014614 |
Genome ID | SRR023845.228205 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 212 |
End posion on genome | 126 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
ctacgagttc |
tRNA gene sequence |
GCGCGAGTGGCGGAATTGGCAGACGCGCTGGCTTCAGGTGCCAGTGCTCGAAAGGGCGTG |
Downstream region at tRNA end position |
acgtgaaggc |
Secondary structure (Cloverleaf model) | >SRA1014614 Leu CAG c ACGA acgtgaaggc G - C C - G G - C C - G G - C A - T G - C T G T C C C C C A T A A G | | | | | A T G G C G G G G G G C G | | | T T G A C G C C A G G TGCTCGAAAGGGCGT C - G T - A G - C G - C C - G T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |