Sequence ID | >SRA1014628 |
Genome ID | SRR023845.232801 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 122 |
End posion on genome | 48 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
gtgtgtatgt |
tRNA gene sequence |
GGGCGTGTAGCTCAGTGGTAGAGCACTGTGTTGACATCGCAGGGGTCGCAAGTTCAATCC |
Downstream region at tRNA end position |
taaaaggccg |
Secondary structure (Cloverleaf model) | >SRA1014628 Val GAC t ACCA taaaaggccg G - C G - C G - C C - G G - C T - A G - C C T T C G T T C A G A A | | | | | A T C T C G G C A A G C G | | | | T T G G A G C T A A GGGTC C - G T - A G - C T + G G - C T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |