Sequence ID | >SRA1014632 |
Genome ID | SRR023845.234274 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 71 |
End posion on genome | 155 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
atcacggaat |
tRNA gene sequence |
GGCCACGTGGTGAAATTGGTAGACACGCCATCTTGAGGGGGTGGTGCTGCAAGGCATGGT |
Downstream region at tRNA end position |
cataaatggc |
Secondary structure (Cloverleaf model) | >SRA1014632 Leu GAG t ACCT cataaatggc G - C G + T C - G C - G A - T C - G G - C T G T T C A C C A T A A G + | | | | G T A G T G G G T G G C G | | | T T G A C A C T A G G TGCTGCAAGGCAT C - G C - G A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |