Sequence ID | >SRA1014633 |
Genome ID | SRR023845.234694 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 40 |
End posion on genome | 113 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
gggtacatat |
tRNA gene sequence |
GGACTATTAGCTCAGCGGTAGTAGCGGTTCCTTTACACGGAAATGGTCGGGGGTTCGAAT |
Downstream region at tRNA end position |
aagttctagg |
Secondary structure (Cloverleaf model) | >SRA1014633 Val TAC t ACtc aagttctagg G - C G - C A - T C - G T + G A - T T - A T A T C T C C C A C G A A | + | | | G G C T C G G G G G G C G | | | T T T T A G C A G G TGGTC G A T - A T - A C - G C - G T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |