Sequence ID | >SRA1014636 |
Genome ID | SRR023845.235406 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 124 |
End posion on genome | 200 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
gggcagccgt |
tRNA gene sequence |
GGTTCCGTAGCTCAGCTGGACAGAGCGCCACTTTCCTAAAGTGGGCGTCGGGGGTTCGAG |
Downstream region at tRNA end position |
ctctcccgct |
Secondary structure (Cloverleaf model) | >SRA1014636 Arg CCT t ACCA ctctcccgct G - C G - C T - A T + G C - G C - G G - C T G T C T C C C A C G A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C A C A G GCGTC C - G C - G A - T C - G T - A T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |