| Sequence ID | >SRA1014656 |
| Genome ID | SRR023845.245707 |
| Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
| Species | |
| Start position on genome | 117 |
| End posion on genome | 28 |
| Amino Acid | Ser |
| Anticodon | TGA |
| Upstream region at tRNA start position |
ggtacaggtt |
| tRNA gene sequence |
GGAAGAGTGTCCGAGTGGTTTAAGGAACTGGTCTTGAAAACCAGCGATGGGGTAACTCAT |
| Downstream region at tRNA end position |
aggcgcggtt |
| Secondary structure (Cloverleaf model) | >SRA1014656 Ser TGA
t GCCA aggcgcggtt
G - C
G - C
A - T
A - T
G - C
A - T
G - C T A
T C A C C C A
T G A G | | | | | G
G G C C T G T G G G C
G | | | T T
T A G G A
T T A A CGATGGGGTAACTCATCC
C - G
T - A
G - C
G - C
T - A
C A
T A
T G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |