Sequence ID | >SRA1014657 |
Genome ID | SRR023845.248180 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 183 |
End posion on genome | 99 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
agacggtcaa |
tRNA gene sequence |
GCCGACGTGGTGAAATTGGTAGACACGCTATCTTGAGGGGGTAGTGGCGAAAGCTGTGCG |
Downstream region at tRNA end position |
ggaattaaga |
Secondary structure (Cloverleaf model) | >SRA1014657 Leu GAG a ACCA ggaattaaga G - C C - G C - G G - C A - T C - G G - C T G T C G C T C A T A A G | | | | | G T A G T G G C G A G C G | | | T T G A C A C T A G G TGGCGAAAGCTGT C - G T - A A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |