Sequence ID | >SRA1014661 |
Genome ID | SRR023845.248822 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 213 |
End posion on genome | 141 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
agtctttccc |
tRNA gene sequence |
GATTTGCTTGTGCAACAGGTCAGCACCCCACTCTTTCACTGTGGTAGTACGGGTTCGAGC |
Downstream region at tRNA end position |
aaacttaatt |
Secondary structure (Cloverleaf model) | >SRA1014661 Glu TTC c Atat aaacttaatt G - C A - T T - A T + G T - A G - C C - G C G T T G C C C A C A A T | | | | | G A C G T G A C G G G C G | | | | T T G G C A C T C A C TAGT C - G C - G A - T C - G T T C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |