Sequence ID | >SRA1014662 |
Genome ID | SRR023845.248822 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 120 |
End posion on genome | 49 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
attattttca |
tRNA gene sequence |
GCCTGATTAGTACAACGGTTAGTACAACTATCTTGTAAATAGTAAATTTGGGTTCGATTC |
Downstream region at tRNA end position |
cgagggcacg |
Secondary structure (Cloverleaf model) | >SRA1014662 Thr TGT a Agtt cgagggcacg G - C C - G C - G T + G G + T A - T T - A T T T G G T C C A C A A A + + + | | G G C A T G T T G G G C G | | | | T T T G T A C T A A AAAT A - T C - G T - A A - T T - A C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |