Sequence ID | >SRA1014663 |
Genome ID | SRR023845.248883 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 164 |
End posion on genome | 237 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
tgaaaataaa |
tRNA gene sequence |
GCGCTCTTAGTTCAGTTCGGTAGAACGCGGGTCTCCAAAACCCGATGTCGTAGGTTCAAA |
Downstream region at tRNA end position |
ccattcttgt |
Secondary structure (Cloverleaf model) | >SRA1014663 Trp CCA a Gatt ccattcttgt G + T C - G G - C C - G T - A C - G T - A T A T C A T C C A T G A A | | | | | A T C T T G G T A G G C C | | | | T T G G A A C G T A G ATGTC C - G G - C G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |