Sequence ID | >SRA1014684 |
Genome ID | SRR023845.262927 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 144 |
End posion on genome | 220 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
tgcctacgcg |
tRNA gene sequence |
GCGGTCGTAGTTCAATTGGTTAGAGCGTCGGCTTGTGATGCCGGATGTTGCGGGTTCAAG |
Downstream region at tRNA end position |
ttttccctta |
Secondary structure (Cloverleaf model) | >SRA1014684 His GTG g CCCA ttttccctta G - C C - G G - C G + T T + G C - G G - C T G T T G C C C A T A A A + | | | | A T C T T G G C G G G C G | | + | T T G G A G C T T A G ATGTT T + G C - G G - C G - C C - G T T T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |