Sequence ID | >SRA1014687 |
Genome ID | SRR023845.263639 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 168 |
End posion on genome | 92 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
accaaaacag |
tRNA gene sequence |
GGCGGGGTAGCTCAGTTGGTTAGAGCACAGGATTCATAACCCTGAGGTCACGAGTTCAAC |
Downstream region at tRNA end position |
gtaaaaaacg |
Secondary structure (Cloverleaf model) | >SRA1014687 Met CAT g ACAA gtaaaaaacg G + T G - C C - G G - C G - C G - C G - C T C T T G C T C A T G A A | | | | | A T C T C G A C G A G C G | | | | T T G G A G C T T A A AGGTC C - G A - T G - C G - C A C T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |