Sequence ID | >SRA1014690 |
Genome ID | SRR023845.264894 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 29 |
End posion on genome | 103 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
ctgcgctggc |
tRNA gene sequence |
GTCTCCTTAGTTAAATGGATATAACGAGCCCCTCCTAAGGGCTAGTTGCAGGTTCGATTC |
Downstream region at tRNA end position |
tatgttagcc |
Secondary structure (Cloverleaf model) | >SRA1014690 Arg CCT c ACCA tatgttagcc G - C T - A C - G T + G C - G C - G T - A T T T C G T C C A T A A A | | | | | G G A T T G G C A G G C G | | | | T T A T A A C T A G AGTT A - T G - C C - G C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |