Sequence ID | >SRA1014700 |
Genome ID | SRR023845.270101 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 221 |
End posion on genome | 146 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
gccgcgttgg |
tRNA gene sequence |
TCCCCAGTAGCTCAGTTGGTAGAGCAGGTGACTGTTAATCACCGGGTCATTGGTTCGAGT |
Downstream region at tRNA end position |
ccgccgcaac |
Secondary structure (Cloverleaf model) | >SRA1014700 Asn GTT g GCCA ccgccgcaac T - A C - G C - G C - G C - G A - T G - C T G T T G A C C A T G A A | + | | | G T C T C G A T T G G C G | | | | T T G G A G C T A A GGGTC G - C G - C T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |