Sequence ID | >SRA1014715 |
Genome ID | SRR023845.277468 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 66 |
End posion on genome | 139 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
cgcctccgac |
tRNA gene sequence |
GCGGGTGTAGTTCAATGGCAGAACGGCAGCTTCCCAAGCTTCATACGAGGGTTCGATTCC |
Downstream region at tRNA end position |
ccgcctcgcc |
Secondary structure (Cloverleaf model) | >SRA1014715 Gly CCC c TCCA ccgcctcgcc G - C C - G G - C G - C G - C T - A G - C T T T T T C C C A A A A + | | | | G T C T T G G A G G G C G | | | | T T G G A A C C A G ATAC G - C C T A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |