Sequence ID | >SRA1014720 |
Genome ID | SRR023845.282359 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 7 |
End posion on genome | 81 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
nnnntcacgc |
tRNA gene sequence |
GCCGCCTTAGCTCAGTGGTAGAGCAACGCTCTCGTAAAGCGTAGGTCCGGGGTTCAAATC |
Downstream region at tRNA end position |
caccaggccc |
Secondary structure (Cloverleaf model) | >SRA1014720 Thr CGT c TCCG caccaggccc G - C C - G C - G G - C C - G C - G T - A T A T G C C C C A G A A | | | | | A T C T C G C G G G G C G | | | | T T G G A G C T A A AGGTC A - T C - G G - C C - G T - A C A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |