Sequence ID | >SRA1014721 |
Genome ID | SRR023845.282491 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 147 |
End posion on genome | 220 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
caggccccgt |
tRNA gene sequence |
AGGGCGGTGGCTCAATTGGTAGAGCAGCGGTCTCCAAAACCGCAGGTTGCAGGTTCGAGT |
Downstream region at tRNA end position |
cccggccggg |
Secondary structure (Cloverleaf model) | >SRA1014721 Trp CCA t GCag cccggccggg A - T G - C G - C G - C C - G G - C G - C T G T T G T C C A T A A G + | | | | G T C T C G G C A G G C G | | | | T T G G A G C T A A AGGTT G - C C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |