Sequence ID | >SRA1014723 |
Genome ID | SRR023845.282941 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 44 |
End posion on genome | 118 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tctcgatgat |
tRNA gene sequence |
GGCGGTGTAGTTCAGCGGTAGAACGGGGGAATCATAATCCCTATGCCGGGGGTTCGAATC |
Downstream region at tRNA end position |
tcgagacctg |
Secondary structure (Cloverleaf model) | >SRA1014723 Met CAT t ACCA tcgagacctg G - C G - C C - G G - C G - C T T G - C T A T C T C C C A G A A | + | | | G C C T T G G G G G G C G | | | | T T G G A A C T A G ATGCC G + T G - C G - C G - C A - T A A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |