Sequence ID | >SRA1014731 |
Genome ID | SRR023845.286775 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 64 |
End posion on genome | 142 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
catcggcctt |
tRNA gene sequence |
CGGAGTGTAGCGCAGTCTGGTAGCGCACCACGTTCGGGACGGTGGGGGTCGGCAGGTTCA |
Downstream region at tRNA end position |
gcttccctca |
Secondary structure (Cloverleaf model) | >SRA1014731 Pro CGG t ACCA gcttccctca C - G G - C G - C A - T G - C T - A G - C T A T C G T C C A T G A A | | | | | A C C G C G G C A G G C T | | | | T T G G C G C G T A A GGGGTCG C - G C T A G C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |