Sequence ID | >SRA1014732 |
Genome ID | SRR023845.286899 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 143 |
End posion on genome | 215 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
gcttctccag |
tRNA gene sequence |
GCGTGTGTAGTATAGTGGTCAGTACCTCACCTTGTGGCGGTGAAATCCCTGGTTCGAATC |
Downstream region at tRNA end position |
ttatgtccat |
Secondary structure (Cloverleaf model) | >SRA1014732 His GTG g ACtc ttatgtccat G - C C - G G - C T + G G - C T - A G - C T A T G G G C C A T G A A | | + | | G G T A T G C C T G G C G + | | | T T T G T A C C A C AATC T - A C - G A - T C - G C - G T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |