Sequence ID | >SRA1014737 |
Genome ID | SRR023845.288798 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 73 |
End posion on genome | 157 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
cgcaacgtat |
tRNA gene sequence |
GCCCAGGTGGCGGAATTGGTAGACGCACTACCTTGAGGTGGTAGCGACTTAGGTCGTAGG |
Downstream region at tRNA end position |
ttgtttggct |
Secondary structure (Cloverleaf model) | >SRA1014737 Leu GAG t ACCA ttgtttggct G - C C - G C - G C - G A - T G + T G - C T G T T C C C C A T A A G | | | | | G T G G C G A G G G G C G | | | T T G A C G C T A G A CGACTTAGGTCGT C - G T - A A - T C - G C - G T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |