Sequence ID | >SRA1014743 |
Genome ID | SRR023845.294358 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 9 |
End posion on genome | 81 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ntgtaatttT |
tRNA gene sequence |
GTCGACTTAGTTTAATGGTAGAATAAATAACTTGTAATTATTTGGTACTAGTTCGATTCT |
Downstream region at tRNA end position |
taccttttaa |
Secondary structure (Cloverleaf model) | >SRA1014743 Thr TGT T ATac taccttttaa G - C T + G C - G G - C A - T C - G T - A T T T T G A T C A A A A | | | | | G T T T T G A C T A G C G + | | + T T G G A A T T A A TGGT A - T A - T T - A A - T A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |