Sequence ID | >SRA1014751 |
Genome ID | SRR023845.299064 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 50 |
End posion on genome | 122 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ctaaagttac |
tRNA gene sequence |
GCCTGTGTGGCTCAGTGGTAGAGCATCTGTCTTGTAAACAGAAGGTCCCCGGTTCAATCC |
Downstream region at tRNA end position |
cttttccacg |
Secondary structure (Cloverleaf model) | >SRA1014751 Thr TGT c ACgc cttttccacg G - C C - G C - G T - A G G T + G G - C C T T G G G C C A G A G | | | | | A T C T C G C C C G G C G | | | | T T G G A G C T A A AGGTC T - A C - G T - A G - C T - A C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |