Sequence ID | >SRA1014754 |
Genome ID | SRR023845.300572 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 222 |
End posion on genome | 138 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
cggtgagtgt |
tRNA gene sequence |
GCGGGTGTGGTGGAATTGGTAGACGCGCTGGACTCAAAATCCTGTTCCGAAAGGAGTGCC |
Downstream region at tRNA end position |
ctcgacgacc |
Secondary structure (Cloverleaf model) | >SRA1014754 Leu CAA t ACCA ctcgacgacc G - C C - G G - C G - C G - C T - A G - C C C T C G G C C A T A A G | | | | | G T G G T G G C C G G C G | + | T T G A C G C T A G G TTCCGAAAGGAGT C - G T T G - C G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |