Sequence ID | >SRA1014758 |
Genome ID | SRR023845.301002 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 50 |
End posion on genome | 133 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tcgtgttttt |
tRNA gene sequence |
GCCGGGATGGCGGAATGGTAGACGCGATGGTCTCAAACACCTTTGTCTGCAAGGACATGC |
Downstream region at tRNA end position |
atagatcctc |
Secondary structure (Cloverleaf model) | >SRA1014758 Leu CAA t ACat atagatcctc G + T C - G C - G G - C G - C G - C A - T T G T C G G C C A T A A G | | | | | G G G G C G G C C G G C G | | | T T T A C G C A G G TGTCTGCAAGGACAT A - T T T G - C G - C T - A C C T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |