Sequence ID | >SRA1014762 |
Genome ID | SRR023845.302087 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 31 |
End posion on genome | 103 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
tgaggatttt |
tRNA gene sequence |
GGGGAATTAACTCAGCGGTAGAGTGCTTCGCTGGCAGCGAAGAAGCCACGAGTTCGAATC |
Downstream region at tRNA end position |
tgacattgtt |
Secondary structure (Cloverleaf model) | >SRA1014762 Ala GGC t ACag tgacattgtt G - C G - C G + T G - C A - T A - T T - A T A T T G C T C A G A A | | | | | G C C T C A A C G A G C G | | | | T T G G A G T T A G AAGCC C - G T - A T - A C - G G - C C G T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |