Sequence ID | >SRA1014769 |
Genome ID | SRR023845.306136 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 68 |
End posion on genome | 142 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
cacaccctcc |
tRNA gene sequence |
CTCGCTGTATTTCAACGGATAGAATTCGGCCCTCCGAAGGCTGAGATCCAGGTTCGATTC |
Downstream region at tRNA end position |
gacactgttc |
Secondary structure (Cloverleaf model) | >SRA1014769 Arg CCG c ACCA gacactgttc C - G T + G C - G G - C C - G T + G G - C T T T G G T C C A C A A A | | | | | G G C T T T C C A G G C G | | | T T A G A A T T A T AGAT C - G G + T G - C C - G C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |