Sequence ID | >SRA1014774 |
Genome ID | SRR023845.309245 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 141 |
End posion on genome | 69 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
tacttggagc |
tRNA gene sequence |
GGCCTCGTGGTCTAGTGGTATGATTCTCGCTTCGGGTGCGAGAGGTCCCGGGTTCGATTC |
Downstream region at tRNA end position |
ctttgctcct |
Secondary structure (Cloverleaf model) | >SRA1014774 Pro CGG c CCgt ctttgctcct G - C G - C C - G C - G T - A C - G G + T T T T G G C C C A G A G | | | | | G T T C T G C C G G G C G | | + T T G T G A T T A T AGGTC C - G T - A C - G G - C C - G T T T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |