Sequence ID | >SRA1014776 |
Genome ID | SRR023845.309857 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 12 |
End posion on genome | 87 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
caaccatctt |
tRNA gene sequence |
GACTCGTTAGCTCAGCCGGTAGAGCAACTGGCTTTTAACCAGTGGGTTCGGGGTTCGAAT |
Downstream region at tRNA end position |
cttgtattcc |
Secondary structure (Cloverleaf model) | >SRA1014776 Lys TTT t ACCA cttgtattcc G - C A - T C - G T - A C - G G - C T - A T A T G C C C C A C G A A | | | | | G C C T C G C G G G G C G | | | | T T G G A G C T A A GGGTT A - T C - G T - A G - C G - C C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |