Sequence ID | >SRA1014780 |
Genome ID | SRR023845.312478 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 158 |
End posion on genome | 232 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
cgctgcggat |
tRNA gene sequence |
GGTCGCGTAGCTCAGTGGGAGAGCACCTCGTTCACACCGAGGGGGTCCACAGTTCGATCC |
Downstream region at tRNA end position |
ttcaactcct |
Secondary structure (Cloverleaf model) | >SRA1014780 Val CAC t ACCA ttcaactcct G - C G - C T - A C - G G - C C - G G - C C T T G T G T C A G A A | | | | | G T C T C G C A C A G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A C - G G - C T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |