Sequence ID | >SRA1014781 |
Genome ID | SRR023845.312946 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 137 |
End posion on genome | 62 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
ggacgggttc |
tRNA gene sequence |
GCCCCCGTAGCTCAGCGGATAGAGCAGGAGCCTTCTAATCTCTTGGTCGCAGGTTCGATT |
Downstream region at tRNA end position |
cgcagcaccc |
Secondary structure (Cloverleaf model) | >SRA1014781 Arg TCT c ACCA cgcagcaccc G - C C - G C - G C - G C - G C - G G - C T T T C G T C C A C G A A | | | | | G G C T C G G C A G G C G | | | | T T A G A G C T A A TGGTC G + T G - C A - T G - C C T C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |