Sequence ID | >SRA1014784 |
Genome ID | SRR023845.313897 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 208 |
End posion on genome | 127 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
atatgttatc |
tRNA gene sequence |
GTCAGTGTGCCCGAGCGGTCTAAGGGGGTAGACTCAAGTTCTACTGTGTTCGCACTCGTG |
Downstream region at tRNA end position |
tactccgctt |
Secondary structure (Cloverleaf model) | >SRA1014784 Leu CAA c Agcc tactccgctt G - C T - A C - G A - T G - C T + G G - C T A T C A C C C A C G A G | | | | | A G G C C C G T G G G C G | | | T T T A G G G C T A G TGTGTTCGCACTC G - C T - A A - T G - C A - T C T T G C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |