Sequence ID | >SRA1014787 |
Genome ID | SRR023845.315801 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 129 |
End posion on genome | 204 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
caacgggaat |
tRNA gene sequence |
GGGGCCGTAGCTCAGCTGGGAGAGCGTTCGCATGGCATGCGAAAGGTCAGGGGTTCGATC |
Downstream region at tRNA end position |
tttccgttga |
Secondary structure (Cloverleaf model) | >SRA1014787 Ala GGC t ACCA tttccgttga G - C G - C G + T G - C C - G C - G G - C C T T T C C C C A C G A A | | | | | G T C T C G A G G G G C G | | | | T T G G A G C G A G AGGTC T - A T - A C - G G - C C - G A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |