Sequence ID | >SRA1014789 |
Genome ID | SRR023845.316208 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 190 |
End posion on genome | 263 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
ttactcgtat |
tRNA gene sequence |
TCCCCGATAGTGTAACGGTAGCACGACTGGTTCTGAGCCAGTTAGTCTTGGTTCGAATCC |
Downstream region at tRNA end position |
cgtttctaga |
Secondary structure (Cloverleaf model) | >SRA1014789 Gln CTG t GCAA cgtttctaga T - A C - G C - G C - G C - G G + T A - T T A T G G A C C A A A A | + | | | G C T G T G C T T G G C G + | | | T T G G C A C T A G TAGT A - T C - G T - A G - C G - C T G T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |