Sequence ID | >SRA1014803 |
Genome ID | SRR023845.319863 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 155 |
End posion on genome | 234 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
tttcgagtaa |
tRNA gene sequence |
GCCGCTATGGTGAAATTGGTAGACACGCTGCTCTTAGGAAGCAGTGCTAGAGCATCTCGG |
Downstream region at tRNA end position |
catcttatct |
Secondary structure (Cloverleaf model) | >SRA1014803 Leu TAG a Atga catcttatct G - C C - G C - G G - C C - G T - A A - T T G T G A G C C A T A A G | | | | | G T A G T G C T C G G C G | | | T T G A C A C T A G G TGCTAGAGCAT C - G T - A G - C C - G T - A C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |