Sequence ID | >SRA1014804 |
Genome ID | SRR023845.320344 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 169 |
End posion on genome | 98 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
tgataaattt |
tRNA gene sequence |
TGTCCGATAGTATAAGGGTAGTACAACGGTTTTTGGTACCGTTTGTCTTGGTTCGAATCC |
Downstream region at tRNA end position |
aaatttaacg |
Secondary structure (Cloverleaf model) | >SRA1014804 Gln TTG t ACag aaatttaacg T - A G - C T - A C - G C - G G - C A - T T A T G G A C C A A A A | + | | | G G T A T G C T T G G C G + | | | T T G G T A C T A A TTGT A - T C - G G - C G - C T - A T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |