Sequence ID | >SRA1014809 |
Genome ID | SRR023845.322740 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 153 |
End posion on genome | 227 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
aattaccaat |
tRNA gene sequence |
GGGTGCGTAGCTCAGCTGGATAGAGCATCTGCCTTCTAAGCAGACGGTCAAAGGTTCGAA |
Downstream region at tRNA end position |
aaaaccacaa |
Secondary structure (Cloverleaf model) | >SRA1014809 Arg TCT t ACtt aaaaccacaa G - C G + T G - C T + G G - C C - G G - C T A T T T T C C A C G A A | | | | | G T C T C G A A A G G C G | | | | T T G G A G C A T A A CGGTC T - A C - G T - A G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |