Sequence ID | >SRA1014812 |
Genome ID | SRR023845.323050 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 164 |
End posion on genome | 237 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
tagaccaact |
tRNA gene sequence |
GCGGGAGTAGCTCAGCTGGTAGAGCGGCAGCCTTCCAAGCTGCAGGTCGCGGGTTCGAAC |
Downstream region at tRNA end position |
ggtccatact |
Secondary structure (Cloverleaf model) | >SRA1014812 Gly TCC t TCac ggtccatact G - C C - G G - C G - C G - C A - T G - C C A T T G C T C A C G A A + | | + | G T C T C G G C G G G C G | | | | T T G G A G C T A G AGGTC G - C C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |